A Brief History of Everyone Who Ever Lived

This is a story about you.

Author: Adam Rutherford

Publisher: Weidenfeld & Nicolson

ISBN: 9781780229072

Category:

Page: 432

View: 303

This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about human history, and what history can now tell us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.

A Brief History of Everyone Who Ever Lived

Author: Adam Rutherford

Publisher: Hachette UK

ISBN: 0297609394

Category: Science

Page: 432

View: 265

'A brilliant, authoritative, surprising, captivating introduction to human genetics. You'll be spellbound' Brian Cox This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about human history, and what history can now tell us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be. *** 'A thoroughly entertaining history of Homo sapiens and its DNA in a manner that displays popular science writing at its best' Observer 'Magisterial, informative and delightful' Peter Frankopan 'An extraordinary adventure...From the Neanderthals to the Vikings, from the Queen of Sheba to Richard III, Rutherford goes in search of our ancestors, tracing the genetic clues deep into the past' Alice Roberts

A Brief History of Everyone Who Ever Lived

This is a story about you.

Author: Adam Rutherford

Publisher: Weidenfeld & Nicolson

ISBN: 9780297609377

Category:

Page: 432

View: 630

This is a story about you. It is the history of who you are and how you came to be. It is unique to you, as it is to each of the 100 billion modern humans who have ever drawn breath. But it is also our collective story, because in every one of our genomes we each carry the history of our species - births, deaths, disease, war, famine, migration and a lot of sex. Since scientists first read the human genome in 2001 it has been subject to all sorts of claims, counterclaims and myths. In fact, as Adam Rutherford explains, our genomes should be read not as instruction manuals, but as epic poems. DNA determines far less than we have been led to believe about us as individuals, but vastly more about us as a species. In this captivating journey through the expanding landscape of genetics, Adam Rutherford reveals what our genes now tell us about history, and what history tells us about our genes. From Neanderthals to murder, from redheads to race, dead kings to plague, evolution to epigenetics, this is a demystifying and illuminating new portrait of who we are and how we came to be.

The Book of Humans

How, then, did we develop the most complex culture ever observed? The Book of Humans proves that we are animals indeed—and reveals how we truly are extraordinary.

Author: Adam Rutherford

Publisher: The Experiment

ISBN: 1615195904

Category: Science

Page: 256

View: 366

“Rutherford describes [The Book of Humans] as being about the paradox of how our evolutionary journey turned ‘an otherwise average ape’ into one capable of creating complex tools, art, music, science, and engineering. It’s an intriguing question, one his book sets against descriptions of the infinitely amusing strategies and antics of a dizzying array of animals.”—The New York Times Book Review Publisher's Note: The Book of Humans was previously published in hardcover as Humanimal. In this new evolutionary history, geneticist Adam Rutherford explores the profound paradox of the human animal. Looking for answers across the animal kingdom, he finds that many things once considered exclusively human are not: We aren’t the only species that “speaks,” makes tools, or has sex outside of procreation. Seeing as our genome is 98 percent identical to a chimpanzee’s, our DNA doesn’t set us far apart, either. How, then, did we develop the most complex culture ever observed? The Book of Humans proves that we are animals indeed—and reveals how we truly are extraordinary.

A Brief History of Everyone Who Ever Lived

National Book Critics Circle Award—2017 Nonfiction Finalist “Nothing less than a tour de force—a heady amalgam of science, history, a little bit of anthropology and plenty of nuanced, captivating storytelling.”—The New York Times ...

Author: Adam Rutherford

Publisher: The Experiment

ISBN: 1615194940

Category: Science

Page: 416

View: 982

National Book Critics Circle Award—2017 Nonfiction Finalist “Nothing less than a tour de force—a heady amalgam of science, history, a little bit of anthropology and plenty of nuanced, captivating storytelling.”—The New York Times Book Review, Editor's Choice A National Geographic Best Book of 2017 In our unique genomes, every one of us carries the story of our species—births, deaths, disease, war, famine, migration, and a lot of sex. But those stories have always been locked away—until now. Who are our ancestors? Where did they come from? Geneticists have suddenly become historians, and the hard evidence in our DNA has blown the lid off what we thought we knew. Acclaimed science writer Adam Rutherford explains exactly how genomics is completely rewriting the human story—from 100,000 years ago to the present.

Creation

Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts ...

Author: Adam Rutherford

Publisher: Penguin UK

ISBN: 0141970227

Category: Science

Page: 272

View: 125

'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Creation

As we come closer and closer to understanding the ancient root that connects all living things, Adam Rutherford shows how we may finally be able to achieve the creation of new life where none existed before.

Author: Adam Rutherford

Publisher: Penguin

ISBN: 1617230111

Category: Science

Page: 288

View: 724

Today’s scientists are radically exceeding the boundaries of evolution and engineering entirely novel creatures. Cutting edge “synthetic biology” may lead to solutions to some of the world’s most pressing crises and pave the way for inventions once relegated to science fiction. Meanwhile, these advances are shedding new light on the biggest mystery of all—how did life begin? As we come closer and closer to understanding the ancient root that connects all living things, Adam Rutherford shows how we may finally be able to achieve the creation of new life where none existed before.

Humans A Brief History of How We F cked It All Up

*NOW AN INTERNATIONAL BESTSELLER* A Toronto Star Bestselling Book of the Year “Witty and entertaining.”—Sarah Knight “Laugh-out-loud.”—Steve Brusatte AN EXHILARATING JOURNEY THROUGH THE MOST CREATIVE AND CATASTROPHIC F*CK-UPS OF ...

Author: Tom Phillips

Publisher: Harlequin

ISBN: 1488051135

Category: History

Page:

View: 365

Modern humans have come a long way in the seventy thousand years they’ve walked the earth. Art, science, culture, trade—on the evolutionary food chain, we’re true winners. But it hasn’t always been smooth sailing, and sometimes—just occasionally—we’ve managed to truly f*ck things up. Weaving together history, science, politics and pop culture, Humans offers a panoramic exploration of humankind in all its glory, or lack thereof. From Lucy, our first ancestor, who fell out of a tree and died, to General Zhou Shou of China, who stored gunpowder in his palace before a lantern festival, to the Austrian army attacking itself one drunken night, to the most spectacular fails of the present day, Humans reveals how even the most mundane mistakes can shift the course of civilization as we know it. Lively, wry and brimming with brilliant insight, this unique compendium offers a fresh take on world history and is one of the most entertaining reads of the year.

The Book of Humans

Explores how many of the things once considered to be exclusively human are not: we are not the only species that communicates, makes tools, utilises fire, or has sex for reasons other than to make new versions of ourselves.

Author: Adam Rutherford

Publisher: Weidenfeld & Nicolson

ISBN: 9780297609407

Category:

Page: 272

View: 888

'Charming, compelling and packed with information. I learned more about biology from this short book than I did from years of science lessons. A weird and wonderful read' PETER FRANKOPAN We like to think of ourselves as exceptional beings, but is there really anything special about us that sets us apart from other animals? Humans are the slightest of twigs on a single family tree that encompasses four billion years, a lot of twists and turns, and a billion species. All of those organisms are rooted in a single origin, with a common code that underwrites our existence. This paradox - that our biology is indistinct from all life, yet we consider ourselves to be special - lies at the heart of who we are. In this original and entertaining tour of life on Earth, Adam Rutherford explores how many of the things once considered to be exclusively human are not: we are not the only species that communicates, makes tools, utilises fire, or has sex for reasons other than to make new versions of ourselves. Evolution has, however, allowed us to develop our culture to a level of complexity that outstrips any other observed in nature. THE BOOK OF HUMANS tells the story of how we became the creatures we are today, bestowed with the unique ability to investigate what makes us who we are. Illuminated by the latest scientific discoveries, it is a thrilling compendium of what unequivocally fixes us as animals, and reveals how we are extraordinary among them. With illustrations by Alice Roberts

Sapiens

Most books about the history of humanity pursue either a historical or a biological approach, but Dr. Yuval Noah Harari breaks the mold with this highly original book that begins about 70,000 years ago with the appearance of modern ...

Author: Yuval Noah Harari

Publisher: Harper Collins

ISBN: 0062316109

Category: Science

Page: 464

View: 776

New York Times Bestseller A Summer Reading Pick for President Barack Obama, Bill Gates, and Mark Zuckerberg From a renowned historian comes a groundbreaking narrative of humanity’s creation and evolution—a #1 international bestseller—that explores the ways in which biology and history have defined us and enhanced our understanding of what it means to be “human.” One hundred thousand years ago, at least six different species of humans inhabited Earth. Yet today there is only one—homo sapiens. What happened to the others? And what may happen to us? Most books about the history of humanity pursue either a historical or a biological approach, but Dr. Yuval Noah Harari breaks the mold with this highly original book that begins about 70,000 years ago with the appearance of modern cognition. From examining the role evolving humans have played in the global ecosystem to charting the rise of empires, Sapiens integrates history and science to reconsider accepted narratives, connect past developments with contemporary concerns, and examine specific events within the context of larger ideas. Dr. Harari also compels us to look ahead, because over the last few decades humans have begun to bend laws of natural selection that have governed life for the past four billion years. We are acquiring the ability to design not only the world around us, but also ourselves. Where is this leading us, and what do we want to become? Featuring 27 photographs, 6 maps, and 25 illustrations/diagrams, this provocative and insightful work is sure to spark debate and is essential reading for aficionados of Jared Diamond, James Gleick, Matt Ridley, Robert Wright, and Sharon Moalem.

How to Argue with a Racist

HOW TO ARGUE WITH A RACIST is a vital manifesto for a twenty-first century understanding of human evolution and variation, and a timely weapon against the misuse of science to justify bigotry.

Author: Adam Rutherford

Publisher: Weidenfeld & Nicolson

ISBN: 9781474611251

Category:

Page: 224

View: 550

Race is real because we perceive it. Racism is real because we enact it. But the appeal to science to strengthen racist ideologies is on the rise - and increasingly part of the public discourse on politics, migration, education, sport and intelligence. Stereotypes and myths about race are expressed not just by overt racists, but also by well-intentioned people whose experience and cultural baggage steer them towards views that are not supported by the modern study of human genetics. Even some scientists are uncomfortable expressing opinions deriving from their research where it relates to race. Yet, if understood correctly, science and history can be powerful allies against racism, granting the clearest view of how people actually are, rather than how we judge them to be. HOW TO ARGUE WITH A RACIST is a vital manifesto for a twenty-first century understanding of human evolution and variation, and a timely weapon against the misuse of science to justify bigotry.

Who We Are and How We Got Here

This book tells the emerging story of our often surprising ancestry - the extraordinary ancient migrations and mixtures of populations that have made us who we are.

Author: David Reich

Publisher: Oxford University Press

ISBN: 0198821255

Category: DNA

Page: 368

View: 288

David Reich describes how the revolution in the ability to sequence ancient DNA has changed our understanding of the deep human past. This book tells the emerging story of our often surprising ancestry - the extraordinary ancient migrations and mixtures of populations that have made us who we are.

A Brief History of Earth

Probably most or even all of the above. The story of our home planet and the organisms spread across its surface is far more spectacular than any Hollywood blockbuster, filled with enough plot twists to rival a bestselling thriller.

Author: Andrew H. Knoll

Publisher: HarperCollins

ISBN: 0062853937

Category: Science

Page: 272

View: 551

Harvard’s acclaimed geologist “charts Earth’s history in accessible style” (AP) “A sublime chronicle of our planet." –Booklist, STARRED review How well do you know the ground beneath your feet? Odds are, where you’re standing was once cooking under a roiling sea of lava, crushed by a towering sheet of ice, rocked by a nearby meteor strike, or perhaps choked by poison gases, drowned beneath ocean, perched atop a mountain range, or roamed by fearsome monsters. Probably most or even all of the above. The story of our home planet and the organisms spread across its surface is far more spectacular than any Hollywood blockbuster, filled with enough plot twists to rival a bestselling thriller. But only recently have we begun to piece together the whole mystery into a coherent narrative. Drawing on his decades of field research and up-to-the-minute understanding of the latest science, renowned geologist Andrew H. Knoll delivers a rigorous yet accessible biography of Earth, charting our home planet's epic 4.6 billion-year story. Placing twenty first-century climate change in deep context, A Brief History of Earth is an indispensable look at where we’ve been and where we’re going. Features original illustrations depicting Earth history and nearly 50 figures (maps, tables, photographs, graphs).

Me Myself and Why

As diverse as people appear to be, all of our genes and brains are nearly identical. In Me, Myself, and Why, Jennifer Ouellette dives into the miniscule ranges of variation to understand just what sets us apart.

Author: Jennifer Ouellette

Publisher: Penguin

ISBN: 1101613645

Category: Science

Page: 368

View: 687

As diverse as people appear to be, all of our genes and brains are nearly identical. In Me, Myself, and Why, Jennifer Ouellette dives into the miniscule ranges of variation to understand just what sets us apart. She draws on cutting-edge research in genetics, neuroscience, and psychology-enlivened as always with her signature sense of humor-to explore the mysteries of human identity and behavior. Readers follow her own surprising journey of self-discovery as she has her genome sequenced, her brain mapped, her personality typed, and even samples a popular hallucinogen. Bringing together everything from Mendel's famous pea plant experiments and mutations in The X-Men to our taste for cilantro and our relationships with virtual avatars, Ouellette takes us on an endlessly thrilling and illuminating trip into the science of ourselves

Doing Our Own Thing

“McWhorter is a gifted young linguist who seeks to understand the change in our verbal habits rather than just bemoan it, and his analysis is insightful, richly documented and, yes, eloquently written.”—Steven Pinker, author of The ...

Author: John McWhorter

Publisher: Penguin

ISBN: 0593330544

Category: Social Science

Page: 304

View: 874

“McWhorter is a gifted young linguist who seeks to understand the change in our verbal habits rather than just bemoan it, and his analysis is insightful, richly documented and, yes, eloquently written.”—Steven Pinker, author of The Blank Slate and The Language Instinct In Doing Our Own Thing, critically acclaimed linguist and cultural critic John McWhorter traces the precipitous decline of language in contemporary America, arguing persuasively that casual everyday speech has conquered the formal in all arenas, from oratory to poetry to everyday journalism—and has even had dire consequences for our musical culture. McWhorter argues that the swift and startling change in written and oral communication emanated from the countercultural revolution of the 1960s and its ideology that established forms and formality were autocratic and artificial. While acknowledging that the evolution of language is, in and of itself, inevitable and often benign, he warns that the near-total loss of formal expression in America is unprecedented in modern history and has reached a crisis point in our culture such that our very ability to convey ideas and arguments effectively is gravely threatened. By turns compelling and harrowing, passionate and judicious, Doing Our Own Thing is required reading for all concerned about the state of our language—and the future of intellectual life in America.

A Pocket History of Human Evolution

A Pocket History of Human Evolution brings us up-to-date on the exploits of all our ancient relatives.

Author: Silvana Condemi

Publisher: The Experiment

ISBN: 1615196048

Category: Science

Page: 160

View: 299

Why aren’t we more like other apes? How did we win the evolutionary race? Find out how “wise” Homo sapiens really are. Prehistory has never been more exciting: New discoveries are overturning long-held theories left and right. Stone tools in Australia date back 65,000 years—a time when, we once thought, the first Sapiens had barely left Africa. DNA sequencing has unearthed a new hominid group—the Denisovans—and confirmed that crossbreeding with them (and Neanderthals) made Homo sapiens who we are today. A Pocket History of Human Evolution brings us up-to-date on the exploits of all our ancient relatives. Paleoanthropologist Silvana Condemi and science journalist François Savatier consider what accelerated our evolution: Was it tools, our “large” brains, language, empathy, or something else entirely? And why are we the sole surviviors among many early bipedal humans? Their conclusions reveal the various ways ancient humans live on today—from gossip as modern “grooming” to our gendered division of labor—and what the future might hold for our strange and unique species.

A Short History of Nearly Everything

A Short History of Nearly Everything is the record of this quest, and it is a sometimes profound, sometimes funny, and always supremely clear and entertaining adventure in the realms of human knowledge, as only Bill Bryson can render it.

Author: Bill Bryson

Publisher: Anchor Canada

ISBN: 0385674503

Category: Science

Page: 624

View: 750

One of the world’s most beloved and bestselling writers takes his ultimate journey -- into the most intriguing and intractable questions that science seeks to answer. In A Walk in the Woods, Bill Bryson trekked the Appalachian Trail -- well, most of it. In In A Sunburned Country, he confronted some of the most lethal wildlife Australia has to offer. Now, in his biggest book, he confronts his greatest challenge: to understand -- and, if possible, answer -- the oldest, biggest questions we have posed about the universe and ourselves. Taking as territory everything from the Big Bang to the rise of civilization, Bryson seeks to understand how we got from there being nothing at all to there being us. To that end, he has attached himself to a host of the world’s most advanced (and often obsessed) archaeologists, anthropologists, and mathematicians, travelling to their offices, laboratories, and field camps. He has read (or tried to read) their books, pestered them with questions, apprenticed himself to their powerful minds. A Short History of Nearly Everything is the record of this quest, and it is a sometimes profound, sometimes funny, and always supremely clear and entertaining adventure in the realms of human knowledge, as only Bill Bryson can render it. Science has never been more involving or entertaining.

The Language of Genes

Surveys the burgeoning study of genetics, from its origins to the current progress in identifying the causes of diseases, the ethical questions raised by bioengineering, and the effect of genes on human sexuality. Reprint.

Author: Steve Jones

Publisher: Anchor Books

ISBN: 9780385474283

Category: Science

Page: 272

View: 185

Surveys the burgeoning study of genetics, from its origins to the current progress in identifying the causes of diseases, the ethical questions raised by bioengineering, and the effect of genes on human sexuality. Reprint.

A History of the Human Brain

“Crack open this book and take a read.

Author: Bret Stetka

Publisher: Timber Press

ISBN: 1643260553

Category: Science

Page: 272

View: 381

“Crack open this book and take a read. You will be transported, illuminated, and delighted.” —Psychology Today Just 125,000 years ago, humanity was on a path to extinction, until a dramatic shift occurred. We used our mental abilities to navigate new terrain and changing climates. We hunted, foraged, tracked tides, shucked oysters—anything we could do to survive. Before long, our species had pulled itself back from the brink and was on more stable ground. What saved us? The human brain—and its evolutionary journey is unlike any other. In A History of the Human Brain, Bret Stetka takes us on this far-reaching journey, explaining exactly how our most mysterious organ developed. From the brain’s improbable, watery beginnings to the marvel that sits in the head of Homo sapiens today, Stetka covers an astonishing progression, even tackling future brainy frontiers such as epigenetics and CRISPR. Clearly and expertly told, this intriguing account is the story of who we are. By examining the history of the brain, we can begin to piece together what it truly means to be human.

The Gene

Throughout, the story of Mukherjee’s own family—with its tragic and bewildering history of mental illness—reminds us of the questions that hang over our ability to translate the science of genetics from the laboratory to the real ...

Author: Siddhartha Mukherjee

Publisher: Simon and Schuster

ISBN: 1476733538

Category: Medical

Page: 608

View: 144

The #1 NEW YORK TIMES Bestseller The basis for the PBS Ken Burns Documentary The Gene: An Intimate History From the Pulitzer Prize–winning author of The Emperor of All Maladies—a fascinating history of the gene and “a magisterial account of how human minds have laboriously, ingeniously picked apart what makes us tick” (Elle). "Sid Mukherjee has the uncanny ability to bring together science, history, and the future in a way that is understandable and riveting, guiding us through both time and the mystery of life itself." –Ken Burns “Dr. Siddhartha Mukherjee dazzled readers with his Pulitzer Prize-winning The Emperor of All Maladies in 2010. That achievement was evidently just a warm-up for his virtuoso performance in The Gene: An Intimate History, in which he braids science, history, and memoir into an epic with all the range and biblical thunder of Paradise Lost” (The New York Times). In this biography Mukherjee brings to life the quest to understand human heredity and its surprising influence on our lives, personalities, identities, fates, and choices. “Mukherjee expresses abstract intellectual ideas through emotional stories…[and] swaddles his medical rigor with rhapsodic tenderness, surprising vulnerability, and occasional flashes of pure poetry” (The Washington Post). Throughout, the story of Mukherjee’s own family—with its tragic and bewildering history of mental illness—reminds us of the questions that hang over our ability to translate the science of genetics from the laboratory to the real world. In riveting and dramatic prose, he describes the centuries of research and experimentation—from Aristotle and Pythagoras to Mendel and Darwin, from Boveri and Morgan to Crick, Watson and Franklin, all the way through the revolutionary twenty-first century innovators who mapped the human genome. “A fascinating and often sobering history of how humans came to understand the roles of genes in making us who we are—and what our manipulation of those genes might mean for our future” (Milwaukee Journal-Sentinel), The Gene is the revelatory and magisterial history of a scientific idea coming to life, the most crucial science of our time, intimately explained by a master. “The Gene is a book we all should read” (USA TODAY).